Overslaan en naar de inhoud gaan

IMIS - Marine Onderzoeksgroepen

[ meld een fout in dit record ] Print deze pagina

Antarctic snow algae communities
Citatie
Davey M, Norman L, Sterk P, Huete-Ortega M, BunBury F, Kin Wai Loh B, Peck L, Conevy P, Newsham K, Smith A (2019): Antarctic snow algae communities. v1.1. SCAR - Microbial Antarctic Resource System. Dataset/Metadata. Https://ipt.biodiversity.aq/resource?r=antarctic_snow_algae_communities&v=1.1 https://doi.org/10.15468/hvpvwh

Toegang tot data
Gearchiveerde data
Beschikbaarheid: Creative Commons License Deze dataset valt onder een Creative Commons Naamsvermelding 4.0 Internationaal-licentie.

Beschrijving
Amplicon sequencing dataset of Eukaryotes (18S-ITS) and Bacteria (16S) in green and red snow algae blooms on Antarctic snow. meer

Snow samples were (1-5cm depth) taken in 6 x 50 ml sterile plastic sample tubes. The algae were collected by filling a sterile 50 ml tube with snow, which was not compacted.

Study Extent: Snow algae communities were collected from layers of green and red dominant snow algal blooms at four locations in Ryder Bay, Antarctic Peninsula (Rothera Point, Anchorage Island, Léonie Island and Lagoon Island) in austral summer (Jan–Feb) 2015.

Method step description:

  1. Samples were returned within 3 h of sampling to the Bonner Laboratory (Rothera Research Station, Ryder Bay, Antarctica), where they were melted in 4 °C lit incubators (Sanyo). 10 ml of snow melt was pelleted using centrifugation (2000 g for 10 min, 4 °C), after which the supernatant was discarded and the remaining algal pellet was flash frozen in liquid nitrogen and stored at -80 °C.
  2. Frozen pellets (approximately 1cm3) of field-collected algal communities from 10 ml snow melt were allowed to thaw before being resuspended in 1 ml of RNase-free water. After transferring to a clean 1.5 ml microfuge tube, the samples were ground with sterilised sand before adding another 1 ml of RNase-free water and subsequent transfer to a 15 ml capacity tube to which 3 ml of SDS-EB buffer (2% SDS, 400 mM NaCl, 40 mM EDTA, 100 mM Tris-HCl, pH8.0) were added, followed by mixing by vortexing and shaking for 5 min at 4 °C. Subsequently, 3 ml of chloroform were added, mixed gently by inversion and the whole suspension was centrifuged for 5 min at 2000 g and 4 °C, resulting in a two phase separation. The top aqueous phase was transferred to a new 15 ml capacity tube and two volumes of 100% chilled ethanol were added before incubating overnight at -20 °C.
  3. The following day, the mix was spun at 6800 g at 0 °C for 30 min. After carefully discharging the supernatant, the pellet was resuspended with 1 ml of ethanol (70%) and recovered in a clean microfuge tube before determining total RNA concentration and quality. Libraries of the fourth hypervariable (V4) domain of 16S rRNA gene and internal transcribed spacer region (ITS) of rRNA gene were produced using the NEXTflexTM “16S V4” and “18S ITS” Amplicon-Seq Library Prep Kit and primers (BIOO Scientific, Austin, TX), respectively. For consistency we hereafter use the term “ITS” for the NEXTflex 18S-ITS region. The microbial 16S rRNA gene forward primer (V4 Forward) sequence was: 5’- GACGCTCTTCCGATCTTATGGTAATTGTGTGCCAGCMGCCGCGGTAA-3’ and the reverse primer (V4 Reverse) sequence was: 5’- TGTGCTCTTCCGATCTAGTCAGTCAGCCGGACTACHVGGGTWTCTAAT-3’. The This article is protected by copyright. All rights reserved. eukaryotic ITS forward primer (18S ITS Forward) sequence CTCTTTCCCTACACGACGCTCTTCCGATCTTCCGTAGGTGAACCTGCGG-3’ reverse primer (18S ITS Forward) CTGGAGTTCAGACGTGTGCTCTTCCGATCTTCCTCCGCTTATTGATATGC-3’. Samples were sequenced by Cambridge Genomic Services (Cambridge, UK) using an Illumina MiSeq v3 600-Cycle Sequencer following the manufacturer’s protocol and primers.

Scope
Kernwoorden:
Terrestrisch, Algenbloei, Dna sequencing, Metadata, Snow, Antarctica, Bacteria

Geografische spreiding
Antarctica [Marine Regions]

Spreiding in de tijd
Vanaf 2015 [Afgelopen]

Taxonomic coverage
Bacteria [WoRMS]

Parameter
Moleculaire data

Bijdrage door
Natural Environment Research Council; British Antarctic Survey (BAS), meerdata creator

Gerelateerde datasets
Gepubliceerd in:
AntOBIS: Antarctic Ocean Biodiversity Information System, meer
(Gedeeltelijk) opgenomen in:
RAS: Register of Antarctic Species, meer

Dataset status: Afgelopen
Data type: Meta database
Data oorsprong: Onderzoek: veldonderzoek
Metadatarecord aangemaakt: 2019-03-28
Informatie laatst gewijzigd: 2019-04-10
Alle informatie in het Integrated Marine Information System (IMIS) valt onder het VLIZ Privacy beleid